6.3.3.10. sam2bed¶
The sam2bed
script converts 1-based, closed [start, end]
Sequence Alignment/Map (SAM) to sorted, 0-based, half-open [start-1, end)
UCSC BED data.
For convenience, we also offer sam2starch
, which performs the extra step of creating a Starch-formatted archive.
The sam2bed
script is “non-lossy” (with the use of specific options, described below). Other toolkits tend to throw out information from the original SAM input upon conversion; sam2bed
retains everything, facilitating reuse of converted data and conversion to other formats.
Tip
Doing the extra step of creating a Starch-formatted archive can save a lot of space relative to the original SAM format, up to 33% of the original SAM dataset, while offering per-chromosome random access.
6.3.3.10.1. Dependencies¶
The sam2bed
wrapper script is dependent upon the installation of SAMtools and convert2bed. The sam2starch
wrapper script is further dependent on the installation of the starch binary, part of a typical BEDOPS installation.
6.3.3.10.2. Source¶
The sam2bed
and sam2starch
conversion scripts are part of the binary and source downloads of BEDOPS. See the Installation documentation for more details.
6.3.3.10.3. Usage¶
The sam2bed
script parses SAM data from standard input and prints sorted BED to standard output. The sam2starch
script uses an extra step to parse SAM to a compressed BEDOPS Starch-formatted archive, which is also directed to standard output.
The header data of a SAM file is usually discarded, unless you add the --keep-header
option. In this case, BED elements are created from these data, using the chromosome name _header
to denote content. Line numbers are specified in the start and stop coordinates, and unmodified header data are placed in the fourth column (ID field).
Tip
If you work with RNA-seq data, you can use the --split
option to process reads with N
-CIGAR operations, splitting them into separate BED elements.
Tip
By default, all conversion scripts now output sorted BED data ready for use with BEDOPS utilities. If you do not want to sort converted output, use the --do-not-sort
option. Run the script with the --help
option for more details.
Tip
If sorting converted data larger than system memory, use the --max-mem
option to limit sort memory usage to a reasonable fraction of available memory, e.g., --max-mem 2G
or similar. See --help
for more details.
6.3.3.10.4. Example¶
To demonstrate these scripts, we use a sample binary input called foo.sam
(see the Downloads section to grab this file).
@HD VN:1.0 SO:coordinate
@SQ SN:seq1 LN:5000
@SQ SN:seq2 LN:5000
@CO Example of SAM/BAM file format.
B7_591:4:96:693:509 73 seq1 1 99 36M * 0 0 CACTAGTGGCTCATTGTAAATGTGTGGTTTAACTCG <<<<<<<<<<<<<<<;<<<<<<<<<5<<<<<;:<;7 MF:i:18 Aq:i:73 NM:i:0 UQ:i:0 H0:i:1 H1:i:0
EAS54_65:7:152:368:113 73 seq1 3 99 35M * 0 0 CTAGTGGCTCATTGTAAATGTGTGGTTTAACTCGT <<<<<<<<<<0<<<<655<<7<<<:9<<3/:<6): MF:i:18 Aq:i:66 NM:i:0 UQ:i:0 H0:i:1 H1:i:0
EAS51_64:8:5:734:57 137 seq1 5 99 35M * 0 0 AGTGGCTCATTGTAAATGTGTGGTTTAACTCGTCC <<<<<<<<<<<7;71<<;<;;<7;<<3;);3*8/5 MF:i:18 Aq:i:66 NM:i:0 UQ:i:0 H0:i:1 H1:i:0
...
We can convert it to sorted BED data in the following manner (omitting standard error messages):
$ sam2bed < foo.sam
seq1 0 36 B7_591:4:96:693:509 99 + 73 36M * 0 0 CACTAGTGGCTCATTGTAAATGTGTGGTTTAACTCG <<<<<<<<<<<<<<<;<<<<<<<<<5<<<<<;:<;7 MF:i:18 Aq:i:73 NM:i:0 UQ:i:0 H0:i:1 H1:i:0
seq1 2 37 EAS54_65:7:152:368:113 99 + 73 35M * 0 0 CTAGTGGCTCATTGTAAATGTGTGGTTTAACTCGT <<<<<<<<<<0<<<<655<<7<<<:9<<3/:<6): MF:i:18 Aq:i:66 NM:i:0 UQ:i:0 H0:i:1 H1:i:0
seq1 4 39 EAS51_64:8:5:734:57 99 + 137 35M * 0 0 AGTGGCTCATTGTAAATGTGTGGTTTAACTCGTCC <<<<<<<<<<<7;71<<;<;;<7;<<3;);3*8/5 MF:i:18 Aq:i:66 NM:i:0 UQ:i:0 H0:i:1 H1:i:0
seq1 5 41 B7_591:1:289:587:906 63 + 137 36M * 0 0 GTGGCTCATTGTAATTTTTTGTTTTAACTCTTCTCT (-&----,----)-)-),'--)---',+-,),''*, MF:i:130 Aq:i:63 NM:i:5 UQ:i:38 H0:i:0 H1:i:0
...
Note also that we strip the header section from the output. If we want to keep this, the use of the --keep-header
option will preserve the BAM file’s header, turning it into BED elements that use _header
as a chromosome name.
Here’s an example:
$ sam2bed --keep-header < foo.sam
_header 0 1 @HD VN:1.0 SO:coordinate
_header 1 2 @SQ SN:seq1 LN:5000
_header 2 3 @SQ SN:seq2 LN:5000
_header 3 4 @CO Example of SAM/BAM file format.
seq1 0 36 B7_591:4:96:693:509 99 + 73 36M * 0 0 CACTAGTGGCTCATTGTAAATGTGTGGTTTAACTCG <<<<<<<<<<<<<<<;<<<<<<<<<5<<<<<;:<;7 MF:i:18 Aq:i:73 NM:i:0 UQ:i:0 H0:i:1 H1:i:0
seq1 2 37 EAS54_65:7:152:368:113 99 + 73 35M * 0 0 CTAGTGGCTCATTGTAAATGTGTGGTTTAACTCGT <<<<<<<<<<0<<<<655<<7<<<:9<<3/:<6): MF:i:18 Aq:i:66 NM:i:0 UQ:i:0 H0:i:1 H1:i:0
seq1 4 39 EAS51_64:8:5:734:57 99 + 137 35M * 0 0 AGTGGCTCATTGTAAATGTGTGGTTTAACTCGTCC <<<<<<<<<<<7;71<<;<;;<7;<<3;);3*8/5 MF:i:18 Aq:i:66 NM:i:0 UQ:i:0 H0:i:1 H1:i:0
seq1 5 41 B7_591:1:289:587:906 63 + 137 36M * 0 0 GTGGCTCATTGTAATTTTTTGTTTTAACTCTTCTCT (-&----,----)-)-),'--)---',+-,),''*, MF:i:130 Aq:i:63 NM:i:5 UQ:i:38 H0:i:0 H1:i:0
...
With this option, the sam2bed
and sam2starch
scripts are completely “non-lossy” (with the exception of unmapped reads; see note below). Use of awk
or other scripting tools can munge these data back into a SAM-formatted file.
Note
The provided scripts strip out unmapped reads from the SAM file. We believe this makes sense under most circumstances. Add the --all-reads
option if you need unmapped and mapped reads.
Note
Note the conversion from 1- to 0-based coordinates. While BEDOPS fully supports 0- and 1-based coordinates, the coordinate change in BED is believed to be convenient to most end users.
6.3.3.10.5. Column mapping¶
In this section, we describe how SAM columns are mapped to BED columns. We start with the first six UCSC BED columns as follows:
SAM field | BED column index | BED field |
---|---|---|
RNAME | 1 | chromosome |
POS - 1 | 2 | start |
POS + length(CIGAR) - 1 | 3 | stop |
QNAME | 4 | id |
MAPQ | 5 | score |
16 & FLAG | 6 | strand |
The remaining SAM columns are mapped as-is, in same order, to adjacent BED columns:
SAM field | BED column index | BED field |
---|---|---|
FLAG | 7 | |
CIGAR | 8 | |
RNEXT | 9 | |
PNEXT | 10 | |
TLEN | 11 | |
SEQ | 12 | |
QUAL | 13 |
Because we have mapped all columns, we can translate converted BED data back to headered or headerless SAM reads with a simple awk
statement (or other script) that reverts back to 1-based coordinates and permutes columns to SAM-based ordering.