6.3.3.2. bam2bed

The bam2bed script converts 0-based, half-open [start-1, end) Binary (Sequence) Alignment/Map (BAM) to sorted, 0-based, half-open [start-1, end) UCSC BED data.

For convenience, we also offer bam2starch, which performs the extra step of creating a Starch-formatted archive.

The bam2bed script is “non-lossy” (with the use of specific options, described below). Other toolkits tend to throw out information from the original BAM input upon conversion; bam2bed can retain everything, facilitating reuse of converted data and conversion to other formats.

Tip

Doing the extra step of creating a Starch-formatted archive can save a lot of space relative to the original BAM format, up to 33% of the original BAM dataset, while offering per-chromosome random access.

6.3.3.2.1. Dependencies

The bam2bed wrapper script is dependent upon the installation of SAMtools and convert2bed. The bam2starch wrapper script is further dependent on the installation of the starch binary, part of a typical BEDOPS installation.

6.3.3.2.2. Source

The bam2bed and bam2starch conversion scripts are part of the binary and source downloads of BEDOPS. See the Installation documentation for more details.

6.3.3.2.3. Usage

The bam2bed script parses BAM data from standard input and prints sorted BED to standard output. The bam2starch script uses an extra step to parse BAM to a compressed BEDOPS Starch-formatted archive, which is also directed to standard output.

The header data of a BAM file is usually discarded, unless you add the --keep-header option. In this case, BED elements are created from these data, using the chromosome name _header to denote content. Line numbers are specified in the start and stop coordinates, and unmodified header data are placed in the fourth column (ID field).

Tip

If you work with RNA-seq data, you may use the --split option to process reads with N-CIGAR operations, splitting them into separate BED elements.

Tip

By default, all conversion scripts now output sorted BED data ready for use with BEDOPS utilities. If you do not want to sort converted output, use the --do-not-sort option. Run the script with the --help option for more details.

Tip

If sorting converted data larger than system memory, use the --max-mem option to limit sort memory usage to a reasonable fraction of available memory, e.g., --max-mem 2G or similar. See --help for more details.

6.3.3.2.4. Example

To demonstrate these scripts, we use a sample binary input called foo.bam (see the Downloads section to grab this file).

We can convert it to sorted BED data in the following manner (omitting standard error messages):

$ bam2bed < foo.bam
seq1    0       36      B7_591:4:96:693:509     99      +       73       36M     *       0       0       CACTAGTGGCTCATTGTAAATGTGTGGTTTAACTCG    <<<<<<<<<<<<<<<;<<<<<<<<<5<<<<<;:<;7    MF:i:18 Aq:i:73 NM:i:0  UQ:i:0  H0:i:1  H1:i:0
seq1    2       37      EAS54_65:7:152:368:113  99      +       73       35M     *       0       0       CTAGTGGCTCATTGTAAATGTGTGGTTTAACTCGT     <<<<<<<<<<0<<<<655<<7<<<:9<<3/:<6):     MF:i:18 Aq:i:66 NM:i:0  UQ:i:0  H0:i:1  H1:i:0
seq1    4       39      EAS51_64:8:5:734:57     99      +       137      35M     *       0       0       AGTGGCTCATTGTAAATGTGTGGTTTAACTCGTCC     <<<<<<<<<<<7;71<<;<;;<7;<<3;);3*8/5     MF:i:18 Aq:i:66 NM:i:0  UQ:i:0  H0:i:1  H1:i:0
seq1    5       41      B7_591:1:289:587:906    63      +       137      36M     *       0       0       GTGGCTCATTGTAATTTTTTGTTTTAACTCTTCTCT    (-&----,----)-)-),'--)---',+-,),''*,    MF:i:130        Aq:i:63 NM:i:5  UQ:i:38 H0:i:0  H1:i:0
...

Note that we strip the header section from the output. If we want to keep this, the use of the --keep-header option will preserve the BAM file’s header, turning it into BED elements that use _header as a chromosome name.

Here’s an example:

$ bam2bed --keep-header < foo.bam
_header 0       1       @HD     VN:1.0 SO:coordinate
_header 1       2       @SQ     SN:seq1 LN:5000
_header 2       3       @SQ     SN:seq2 LN:5000
_header 3       4       @CO     Example of SAM/BAM file format.
seq1    0       36      B7_591:4:96:693:509     99      +       73       36M     *       0       0       CACTAGTGGCTCATTGTAAATGTGTGGTTTAACTCG    <<<<<<<<<<<<<<<;<<<<<<<<<5<<<<<;:<;7    MF:i:18 Aq:i:73 NM:i:0  UQ:i:0  H0:i:1  H1:i:0
seq1    2       37      EAS54_65:7:152:368:113  99      +       73       35M     *       0       0       CTAGTGGCTCATTGTAAATGTGTGGTTTAACTCGT     <<<<<<<<<<0<<<<655<<7<<<:9<<3/:<6):     MF:i:18 Aq:i:66 NM:i:0  UQ:i:0  H0:i:1  H1:i:0
seq1    4       39      EAS51_64:8:5:734:57     99      +       137      35M     *       0       0       AGTGGCTCATTGTAAATGTGTGGTTTAACTCGTCC     <<<<<<<<<<<7;71<<;<;;<7;<<3;);3*8/5     MF:i:18 Aq:i:66 NM:i:0  UQ:i:0  H0:i:1  H1:i:0
seq1    5       41      B7_591:1:289:587:906    63      +       137      36M     *       0       0       GTGGCTCATTGTAATTTTTTGTTTTAACTCTTCTCT    (-&----,----)-)-),'--)---',+-,),''*,    MF:i:130        Aq:i:63 NM:i:5  UQ:i:38 H0:i:0  H1:i:0
...

With this option, the bam2bed and bam2starch scripts are completely “non-lossy” (with the exception of unmapped reads; see note below). Use of awk or other scripting tools can munge these data back into a SAM-formatted file.

Note

The provided scripts strip out unmapped reads from the BAM file. We believe this makes sense under most circumstances. Add the --all-reads option if you need unmapped and mapped reads.

6.3.3.2.5. Column mapping

In this section, we describe how non-header BAM data (converted to SAM columns) are mapped to BED columns. We start with the first six UCSC BED columns as follows:

SAM field BED column index BED field
RNAME 1 chromosome
POS - 1 2 start
POS + length(CIGAR) - 1 3 stop
QNAME 4 id
MAPQ 5 score
16 & FLAG 6 strand

The remaining SAM-converted columns are mapped as-is, in same order, to adjacent BED columns:

SAM field BED column index BED field
FLAG 7  
CIGAR 8  
RNEXT 9  
PNEXT 10  
TLEN 11  
SEQ 12  
QUAL 13  

Because we have mapped all columns, we can translate converted BED data back to headered or headerless SAM reads with a simple awk statement (or other script) that reverts back to 1-based coordinates and permutes columns to SAM-based ordering.

6.3.3.2.6. Downloads